View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10335_low_8 (Length: 238)
Name: NF10335_low_8
Description: NF10335
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10335_low_8 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 16 - 238
Target Start/End: Complemental strand, 3568753 - 3568531
Alignment:
| Q |
16 |
gttgctcctcactgtgcacgccctcataatctaaatgtgctatgttggccgagttagcaagatcattctgctgatgcgccaatgtgggtgaggagccaga |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3568753 |
gttgctcctcactgtgcacgccctcataatccaaatgtgctatgttggccgagttagcaagatcattctgctgatgcgccaatgtgggtgaggagccaga |
3568654 |
T |
 |
| Q |
116 |
agggcgtattccttcaatcgtgtggtctatgcacacttcctcttgggagaaatgttggaccagcaaaggagattgctctctagcagaaaccaaatcagta |
215 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3568653 |
agggcgtattccttcaatcatgtggtctatgcacacttcctcttgggagaaatgttggaccagcaaaggagattcctctctagcagaaaccaaatcagta |
3568554 |
T |
 |
| Q |
216 |
gaagccaaatcatcatgcacttc |
238 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
3568553 |
gaagccaaatcatcatgcacttc |
3568531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University