View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10336_high_16 (Length: 270)
Name: NF10336_high_16
Description: NF10336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10336_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 55452272 - 55452001
Alignment:
| Q |
1 |
ctagctaatggaaataaataaatttatctgcacaaacattgtttacatacctctcctacgtaccgttgcatttttggcacctgaaaatggctgctaccat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55452272 |
ctagctaatggaaataaataaatttatctgcacaaacattgtttacatacctctcctacgtaccgttgcatttttggcacctgaaaatggctgctaccag |
55452173 |
T |
 |
| Q |
101 |
ctagggatggcaaaaacaccc--------------------ataaaatctaacacggttacaggctcataccttgataaagtaagggtaaaatgacttaa |
180 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
55452172 |
ctagggatggcaaaaacaccctacccggcgggtatccactaataaaatctgacacggttacaggctcataccttgataaagtaagtgtaaaatgacttaa |
55452073 |
T |
 |
| Q |
181 |
atatccttaggttaagtataaaagttagcagttccgtcaaaacaccccagatatcaactatttaggttattt |
252 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55452072 |
atatccttaggttaagtataaaatttagcagttccgtcaaaacaccccagatatcaactatttaggttattt |
55452001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University