View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10336_low_10 (Length: 407)
Name: NF10336_low_10
Description: NF10336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10336_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 19 - 239
Target Start/End: Complemental strand, 4065281 - 4065061
Alignment:
| Q |
19 |
ggaatagtaataatctagtggaggtttttgtgcaaggtgttggtggtgaaagtttgataagaactagttctttaactactcgtgttggtggacttggttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4065281 |
ggaatagtaataatctagtggaggtttttgtgcaaggtgttggtggtgaaagtttgataagaactagttctttaactactcgtgttggtggacttggttt |
4065182 |
T |
|
| Q |
119 |
gaatggtgaaaaggaattggatcaagttgttcctccttcaccacaaggtggtggtggttcaattggttcttcttctggtacttcagaatctgagggtcaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4065181 |
gaatggtgaaaaggaattggatcaagttgttcctccttcaccacaaggtggtggtggttcaattggttcttcttcgggtacttcagaatctgagggtcaa |
4065082 |
T |
|
| Q |
219 |
caacatggtcaaggtaaatga |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
4065081 |
caacatggtcaaggtaaatga |
4065061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 302 - 388
Target Start/End: Complemental strand, 4064998 - 4064911
Alignment:
| Q |
302 |
gttgttgataaattagtgtttttt-gaagtcgggtcaggtctaggttatccttgaagaatcgtggataatttactttaatttttgttg |
388 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4064998 |
gttgttgataaattagtgtttttttgaagtcgagtcaggtctaggttatttttgaagaatcgtggataatttactttaatttttgttg |
4064911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 302 - 375
Target Start/End: Complemental strand, 4064908 - 4064835
Alignment:
| Q |
302 |
gttgttgataaattagtgttttttgaagtcgggtcaggtctaggttatccttgaagaatcgtggataatttact |
375 |
Q |
| |
|
||||||||| ||||||||||| || |||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4064908 |
gttgttgatgaattagtgtttctttaagttgggtcaggtcgaggttatccttgaagaatcgtggataatttact |
4064835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University