View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10336_low_17 (Length: 270)

Name: NF10336_low_17
Description: NF10336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10336_low_17
NF10336_low_17
[»] chr4 (1 HSPs)
chr4 (1-252)||(55452001-55452272)


Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 55452272 - 55452001
Alignment:
1 ctagctaatggaaataaataaatttatctgcacaaacattgtttacatacctctcctacgtaccgttgcatttttggcacctgaaaatggctgctaccat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
55452272 ctagctaatggaaataaataaatttatctgcacaaacattgtttacatacctctcctacgtaccgttgcatttttggcacctgaaaatggctgctaccag 55452173  T
101 ctagggatggcaaaaacaccc--------------------ataaaatctaacacggttacaggctcataccttgataaagtaagggtaaaatgacttaa 180  Q
    |||||||||||||||||||||                    ||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||    
55452172 ctagggatggcaaaaacaccctacccggcgggtatccactaataaaatctgacacggttacaggctcataccttgataaagtaagtgtaaaatgacttaa 55452073  T
181 atatccttaggttaagtataaaagttagcagttccgtcaaaacaccccagatatcaactatttaggttattt 252  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
55452072 atatccttaggttaagtataaaatttagcagttccgtcaaaacaccccagatatcaactatttaggttattt 55452001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University