View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10336_low_20 (Length: 258)
Name: NF10336_low_20
Description: NF10336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10336_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 18 - 249
Target Start/End: Complemental strand, 45975704 - 45975473
Alignment:
| Q |
18 |
cttcttaccttcttcctcgtcattgcacatcacccacagatacggattcatccccagtatgttgtaaaatccatcacttatcttatccgtatacgacaag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45975704 |
cttcttaccttcttcctcgtcattgcacatcacccacagatacggattcatccccagtatgttgtaaaatccatcacttatcttatccgtatatgacaag |
45975605 |
T |
 |
| Q |
118 |
cacccactcacctgataaccaaaaatggcatatttaatcacacaaatattattgaacgctagttgcaatatggttttaagttgttatctgaagctgcttc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45975604 |
cacccactcacctgataaccaaaaatggcatatttaatcacacaaatattaatgaacgctagttgcaatatggttttaagttgttatctgcagctgcttc |
45975505 |
T |
 |
| Q |
218 |
aactgcaatataaaagattttgagatctctgc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
45975504 |
aactgcaatataaaagattttgagatctctgc |
45975473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 36 - 92
Target Start/End: Original strand, 28052879 - 28052935
Alignment:
| Q |
36 |
gtcattgcacatcacccacagatacggattcatccccagtatgttgtaaaatccatc |
92 |
Q |
| |
|
|||||| ||||| ||||||| |||||||||||| |||| |||||| ||||||||||| |
|
|
| T |
28052879 |
gtcattacacataacccacaaatacggattcattcccaatatgttataaaatccatc |
28052935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University