View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10336_low_21 (Length: 250)
Name: NF10336_low_21
Description: NF10336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10336_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 14 - 246
Target Start/End: Original strand, 45975073 - 45975305
Alignment:
| Q |
14 |
agacgggttggtgaagaagtgtgaagaaagctatatcctgcagcttacgttagcgaagaggcttgcttctttggcaagtcttgtgtcggagcctgttctc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45975073 |
agacgggttggtgaagaagtgtgaagaaagctatatcctgcagcttacgttagcgaagaggcttgcttctttggcaagtcttgtgtcggagcctgttctc |
45975172 |
T |
 |
| Q |
114 |
actcctggcactgaaaattgggatgctgagtctgtttcttatcgtctatgggtacaaaactaaacaagattgcacaaccatttcattttttaactacgtc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
45975173 |
actcctggcactgaaaattgggatgctgagtctgtttcttatcgtctatgggtacaaaactaaacaagattgcacaaccatttcattttttaactacatc |
45975272 |
T |
 |
| Q |
214 |
tcaccatcgcaccaatggttttaaatcgcggtt |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
45975273 |
tcaccatcgcaccaatggttttaaatcgcggtt |
45975305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University