View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10336_low_22 (Length: 249)
Name: NF10336_low_22
Description: NF10336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10336_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 93 - 239
Target Start/End: Original strand, 17319779 - 17319925
Alignment:
| Q |
93 |
tttaagtagattgaatatatctccttgtatcttctatgagtggagttggaacccgaacgagtgcttaaaaagatgatttgggtgcggtgtttggctcacc |
192 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17319779 |
tttaagtagattgaatatatctccctgtatcttctatgagtggagttggaacccgaacgagtgcttaaaaagatgatttgggtgcggtgtttggctcacc |
17319878 |
T |
 |
| Q |
193 |
cagtccatggaatttagcttttgctagagggactaacttatcctttg |
239 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
17319879 |
cagtccatggaatttagcttttgctagggagactaacttatcctttg |
17319925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 74 - 148
Target Start/End: Complemental strand, 6437966 - 6437892
Alignment:
| Q |
74 |
tgttatcttggcatttgtgtttaagtagattgaatatatctccttgtatcttctatgagtggagttggaacccga |
148 |
Q |
| |
|
|||| |||||||||| | ||||||| | |||||||||| | ||||| | |||||||||||| |||||||||||| |
|
|
| T |
6437966 |
tgttgtcttggcattggagtttaagaaaattgaatatagcaacttgtttgttctatgagtggtgttggaacccga |
6437892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University