View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10336_low_25 (Length: 208)
Name: NF10336_low_25
Description: NF10336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10336_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 1e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 20 - 192
Target Start/End: Original strand, 9366232 - 9366401
Alignment:
| Q |
20 |
cagtccacttcttagaacacccgaattctttcataccaataatcttaaatattgtataattctttcttcacatgtatcaaaacataacctctcttnnnnn |
119 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
9366232 |
cagtccacttctta---cacccgaattctttcataccaataatcttaaatattgtataattctttcttcacatgtatcaaaatataacccctcttaaaaa |
9366328 |
T |
|
| Q |
120 |
nntatcacgattttcacacaaaattaatacgattttcatatttacaattttcacaaaaaattaatacatgtct |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9366329 |
aatatcacgattttcacacaaaattaatacgattttcatatttacaattttcacaaaaaattaatacatgtct |
9366401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 56 - 114
Target Start/End: Original strand, 9370518 - 9370576
Alignment:
| Q |
56 |
caataatcttaaatattgtataattctttcttcacatgtatcaaaacataacctctctt |
114 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||| ||| |||||||| |||||||||| |
|
|
| T |
9370518 |
caataatcttaaatgttgtataattctatcttcagatgcatcaaaactgaacctctctt |
9370576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University