View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10337_low_14 (Length: 295)
Name: NF10337_low_14
Description: NF10337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10337_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 277
Target Start/End: Original strand, 46618621 - 46618896
Alignment:
| Q |
1 |
aaaacaattgcagcgtgattaataatcacatcatgaacacaatgctgtgataaaaaagtggaaagtttatgtggtgagatttctaaaatgattacattaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46618621 |
aaaacaattgcagcgtgattaataatcacatcatgaacacaatgctgtgataaaaaagtggaaagtt-atgtggtgagatttctaaaatgattacattaa |
46618719 |
T |
|
| Q |
101 |
agagaagactataaaggtgtgattaatagaacgtgctatttttatgattgaatgggttgattgacgcattaatatacactttgatttgaaacatagcatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46618720 |
agagaagactataaaggtgtgattaatagaacgtgctatttttatgattgaatgggttgattcacgcattaatatacactttgatttgaaacatagcatt |
46618819 |
T |
|
| Q |
201 |
aaagaatgtatctttttgttaagaactgtttcttctcatcaagttttgcatgttgctctacaaatagacaacttcac |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46618820 |
aaagaatgtatctttttgttaagaactgtttcttctcatcaagttttgcatgttgctctacaaatagacaacttcac |
46618896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University