View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10337_low_16 (Length: 287)
Name: NF10337_low_16
Description: NF10337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10337_low_16 |
 | |
|
| [»] scaffold0200 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0200 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: scaffold0200
Description:
Target: scaffold0200; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 20 - 273
Target Start/End: Complemental strand, 30093 - 29840
Alignment:
| Q |
20 |
ttactatcaaatttcaggcaaatcatgttgatttttacatgaatgggcatgatcactgtcttgaacatatcagtgatttaagcaggtaaacattaaatga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30093 |
ttactatcaaatttcaggcaaatcatgttgatttttacatgaatgggcatgatcactgtcttgaacatatcagtgatttaagcaggtaaacattaaatga |
29994 |
T |
|
| Q |
120 |
aagcatataaagtttaattttaattttgatcaatcaattatagatcatgtgcatgatatcttaaggtagttaagaacaaaattaaatattttgtttaaat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
29993 |
aagcatataaagtttaattttaattttgatcaatcaattatagatcatgggcatgatattttaaggcagttaagaacaaaattaaatattttatttaaat |
29894 |
T |
|
| Q |
220 |
ttgacaattatgattgatcaataatataaacttttctttatattgacgattcat |
273 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29893 |
ttaacaattatgattgatcaataatataaacttttctttatattgacgattcat |
29840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University