View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10337_low_17 (Length: 270)
Name: NF10337_low_17
Description: NF10337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10337_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 234
Target Start/End: Original strand, 31530441 - 31530658
Alignment:
| Q |
18 |
tgaattaggtcataggttgcaacattctctaaagctattcaggttttttccgtggcaaaccaagccaattgataaagtatattaacgagtccaataataa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31530441 |
tgaattaggtcataggttgcaacattctctaaagctatacaggttttttcagtggcaaaccaagccgattgataaagtatattaacgagtccaataataa |
31530540 |
T |
 |
| Q |
118 |
ggtttaacaagacttacaacaatggaaaagaatcggttgaaaatccacgccacacctaactaaaaacatgtatatattact-gagcactagccaaatgta |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31530541 |
ggtttaacaagacttacaacaatggaaaagaatcggttgaaaatccacgccacacctaactaaaaacatgtatatattactggagcactagccaaatgta |
31530640 |
T |
 |
| Q |
217 |
aaggaaaaattgcaaagg |
234 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
31530641 |
aaggaaaaattgcaaagg |
31530658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University