View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10337_low_21 (Length: 249)
Name: NF10337_low_21
Description: NF10337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10337_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 50 - 246
Target Start/End: Original strand, 46618262 - 46618457
Alignment:
| Q |
50 |
aattagtaatgtcaaagattagggttaatatccaaagtgggggacctttcacgcgacttaatgaaaaaagttgaagcagcgtcggtatcaagctgttact |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46618262 |
aattagtaatgtcaaagattagggttaatatccaaagtgggg-acctttcacgcgacttaatgaaaaaagttgaagcagcgtcggtatcaagctgttact |
46618360 |
T |
|
| Q |
150 |
atgaaagtttgacaagtatacattgcaaataaagttccttttatgtatggtgcatacgtaggggaatgatttaggctttcctaatttttctgcttct |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46618361 |
atgaaagtttgacaagtatacattgcaaataaagttccttttatgtatggtgcatacgtaggggaatgatttaggctttcctaatttttctgcttct |
46618457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University