View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10337_low_22 (Length: 248)
Name: NF10337_low_22
Description: NF10337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10337_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 11 - 238
Target Start/End: Original strand, 1052764 - 1052993
Alignment:
| Q |
11 |
gagacgagagaaattggagtaattttcttcaatggttgtttaataggaagttcaaaattgcccatcttctcgaaaaaagcctgtaaaaagctacgatgca |
110 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
1052764 |
gagacgagagaaattggagtaattttcgtcaatggttgtttaataggaagttcaaaattgcccatcttctcgaaaaaagcctgtaaaaagttaggatgca |
1052863 |
T |
 |
| Q |
111 |
attatattttacatataaaaatagtcgattaagagttatgatccgatcgaaaccaaaattgaggtgc--ttgtgcaattgtcattttctgctgccttttt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1052864 |
attatattttacatataaaaatagtcgattaagagttatgatccgatcgaaaccaaaattgaggtgctattgtgcaattgtcattttctgctgccttttt |
1052963 |
T |
 |
| Q |
209 |
atttctccatagtttcgttgcctttttgtt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1052964 |
atttctccatagtttcgttgcctttttgtt |
1052993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 116 - 145
Target Start/End: Complemental strand, 16827603 - 16827574
Alignment:
| Q |
116 |
attttacatataaaaatagtcgattaagag |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
16827603 |
attttacatataaaaatagtcgattaagag |
16827574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University