View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10337_low_24 (Length: 239)
Name: NF10337_low_24
Description: NF10337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10337_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 12 - 224
Target Start/End: Original strand, 7301535 - 7301738
Alignment:
| Q |
12 |
agttcagattaaaacttctctatttctttgaaggttacttggttaaaacatgacgcaaagggcacaaatgcaacagctatgtttagaaaagggtcagtgg |
111 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
7301535 |
agttcaaattaaaacttctctttttctttgaaggttacttggttaaaacatgacgcaaagggcacaaatgcaacaactaagtttagaaaagggtcagtg- |
7301633 |
T |
|
| Q |
112 |
cactgatgacacacatagtttacgtgttgcattcagatgagtaaaaggaactatgtaaatggatctcaaggttcgatgtgtggcctttcctgacaaatta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7301634 |
--------acacacatagtttacgtgttgcattcagatgagtaaaaggaactatgtaaatggatctcaaggttcgatgtgtggcctttcctgacaaatta |
7301725 |
T |
|
| Q |
212 |
tacagaggtaaat |
224 |
Q |
| |
|
||||||||||||| |
|
|
| T |
7301726 |
tacagaggtaaat |
7301738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 19 - 223
Target Start/End: Complemental strand, 44516836 - 44516632
Alignment:
| Q |
19 |
attaaaacttctctatttctttgaaggttacttggttaaaacatgacgcaaagggcacaa-atgcaacagctatgtttagaaaagggtcagtggcactga |
117 |
Q |
| |
|
|||| ||||| ||| ||||||||||||||||| |||||| || ||| |||||||| |||| ||||||| | | |||||| | |||||||||||||| |
|
|
| T |
44516836 |
attataacttgtctgtttctttgaaggttactaggttaatacctgatgcaaaggggacaacatgcaac--cagagactagaaa-gagtcagtggcactga |
44516740 |
T |
|
| Q |
118 |
tgacacacatagtttacgtgttgcattcagatgagtaaaaggaactat--gtaaatggatctcaaggttcgatgtgtggcctttcctgacaaattataca |
215 |
Q |
| |
|
| | ||||||| ||| |||||| ||||||||| || |||||||| | | ||||||||||||||||||| ||||| |||||||||||| || |||| || |
|
|
| T |
44516739 |
ttatacacatattttgcgtgttccattcagatcagaaaaaggaattctccgtaaatggatctcaaggtttgatgtctggcctttcctggaaacttatgca |
44516640 |
T |
|
| Q |
216 |
gaggtaaa |
223 |
Q |
| |
|
|||||||| |
|
|
| T |
44516639 |
gaggtaaa |
44516632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 9929105 - 9929050
Alignment:
| Q |
154 |
aaaaggaactatgtaaatggatctcaaggttcgatgtgtggcctttcctgacaaat |
209 |
Q |
| |
|
|||| ||||||||||||||| ||||||| || ||||||||||||| |||| ||||| |
|
|
| T |
9929105 |
aaaatgaactatgtaaatggttctcaagttttgatgtgtggccttgcctgtcaaat |
9929050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 166 - 199
Target Start/End: Original strand, 39399058 - 39399091
Alignment:
| Q |
166 |
gtaaatggatctcaaggttcgatgtgtggccttt |
199 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
39399058 |
gtaaatggatctcaaggtttgatgtgtggccttt |
39399091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University