View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10337_low_25 (Length: 204)

Name: NF10337_low_25
Description: NF10337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10337_low_25
NF10337_low_25
[»] chr4 (1 HSPs)
chr4 (18-172)||(43540536-43540690)


Alignment Details
Target: chr4 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 18 - 172
Target Start/End: Original strand, 43540536 - 43540690
Alignment:
18 tgtatgagattgatgcttttatggatgaatgccaatcacaaagtaaatatcactcaaaatgcaacttctttcatcagtgtatttgcttttcaggcaagtc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43540536 tgtatgagattgatgcttttatggatgaatgccaatcacaaagtaaatatcactcaaaatgcaacttctttcatcagtgtatttgcttttcaggcaagtc 43540635  T
118 aagttaattatggctttctttaaattaatatcatagcatagcatgtataattcta 172  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
43540636 aagttaattatggctttctttaaattaatatcatagcatagcaggtataattcta 43540690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University