View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10337_low_5 (Length: 367)
Name: NF10337_low_5
Description: NF10337
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10337_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 20 - 151
Target Start/End: Original strand, 20921453 - 20921586
Alignment:
| Q |
20 |
cctagcaatacaactcacacattaaatgttaattagtggataattgtgggttt--gaatatgctttcaacatatcaaacgtctttgcaactatgtaccat |
117 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||||||||| |||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
20921453 |
cctagcaatacaactcacacattaagtgttaatgagtggataattgtgggtttctgaatctgctttcaacatatcaaacgtccttgcaactatgtaccat |
20921552 |
T |
|
| Q |
118 |
ctgatactatttacgtgatcaatgtcatgatatt |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
20921553 |
ctgatactatttacgtgatcaatgtcatgatatt |
20921586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 151 - 316
Target Start/End: Original strand, 20921640 - 20921813
Alignment:
| Q |
151 |
tctttttaatttttcttaaatcctacacaaaatcaaatctttggctttaaaatgaattttgggaatagaa--agtgatttcaagttttaaaaagaataga |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
20921640 |
tctttttaatttttcttaaatcctacacaaaatcaaatttttggctttaaaatgaaatttgggaatagaaatagtgatttcaaattttaaaaagaataga |
20921739 |
T |
|
| Q |
249 |
aaatgaaag------nnnnnnnnnnnaataaagatatgattttaatatagtattttacagtgataataaacctc |
316 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
20921740 |
aaatgaaagttttttttatttttttaaataaagatatgattttaatatagtattttaccgtgacaataaacctc |
20921813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University