View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10338_low_8 (Length: 252)
Name: NF10338_low_8
Description: NF10338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10338_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 47727611 - 47727380
Alignment:
| Q |
1 |
ttctgtgaacattatagattcaattgaaatataaatgtatagatcctaatgtaa-ccatggcccatggcctgattaaattaagtttcatctgtagctgtc |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |||||||||||| |||| |
|
|
| T |
47727611 |
ttctgtgaacattatagattcaattgaaatataaatgtatagatcctaatgtaaaccatggcacatggcctgattaaa----gtttcatctgtaactgtg |
47727516 |
T |
|
| Q |
100 |
atatgattaattaatgtacatttgttaaaatttcaacactgctcttattttagctaacgcttgtgtatgttattaacttatttgatgtctttttccaaaa |
199 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47727515 |
atatgattaattaatgtacattagttaaaatttcaacactgctcttattttagctaacgcttgtgtatgttattaacttatttgatgtctttttccaaaa |
47727416 |
T |
|
| Q |
200 |
tttagcagatgcttaatgcaatagaaatgttaagga |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
47727415 |
tttagcagatgcttaatgcaatagaaatgttaagga |
47727380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University