View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10339_low_10 (Length: 295)
Name: NF10339_low_10
Description: NF10339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10339_low_10 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 17 - 295
Target Start/End: Complemental strand, 2972772 - 2972494
Alignment:
| Q |
17 |
atatgaaattgtacagcaacgcgtacaccggttgtccttggtggacaacgtttggtatgatggtttttgtttgttagttttctgtttccgacaaatgcca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2972772 |
atatgaaattgtacagcaacgcgtacactggttgtccttggtggacaacgtttggtatgatggtttttgtttgttagttttctgtttccgacaaatgcca |
2972673 |
T |
 |
| Q |
117 |
actcagcggtactatcctatctgattaggacggaaagtagattcagatgtacaccaatctcgaagagacgacaaacactgctcttttcttcnnnnnnnag |
216 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || |
|
|
| T |
2972672 |
actcagcggtactatccaatctgattaggacggaaagtagattcagatgtacaccaatctcgaagagacaacaaacactgctcttttcttctttttttag |
2972573 |
T |
 |
| Q |
217 |
atattttaatatttacatttcatatcaaattttggtaataatcaaataaagatccatattgaaatgagttgtgttattt |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||| | ||||| ||||||| ||||||||||| |
|
|
| T |
2972572 |
atattttaatatttacatttcatatcaaattttgttaataatcaaataaagcttcatatagaaatgacttgtgttattt |
2972494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University