View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10339_low_11 (Length: 281)
Name: NF10339_low_11
Description: NF10339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10339_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 42270930 - 42270669
Alignment:
| Q |
1 |
ctgaaattctaacgcacattatttcgtgatattgagactagttttcatcataacatatagcacaattgtaataattaacaatatacgaaacttacgataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42270930 |
ctgaaattctaacgcacattatttcgtgatattgagactagttttcattataacatatagcacaattgtaataattaacaatttacgaaacttacgataa |
42270831 |
T |
 |
| Q |
101 |
aacatgactccatagttggttatccgaagcatgttcggccatgaagtcgttggaggaaggtggtgcatgcggctcgacgaatactcttcgagaggattca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42270830 |
aacatgactccatagttggttatccgaagcatgttcggccatgaagtcgttggaggaaggtggtgcatgcggctcgacgaatactcttcgagaggattca |
42270731 |
T |
 |
| Q |
201 |
acagtgaggcttgaatggtttgatgcattggtgaaagatgtagaagaaactgatatatcttg |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42270730 |
acagtgaggcttgaatggtttgatgcattggtgaaagatgtagaagaaactgatatatcttg |
42270669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University