View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10339_low_14 (Length: 251)
Name: NF10339_low_14
Description: NF10339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10339_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 7 - 238
Target Start/End: Original strand, 36276236 - 36276470
Alignment:
| Q |
7 |
gagattgatttcaattggtttaagttggatttgattaagagatcattacaattggcatcgtggaacataaaattgtggtgttgaagttgcattattaata |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36276236 |
gagattgatttcaattggtttaagttggatttgattaagagatcattacaattggcatagtggaacataaaattgtggtgttgaagttgcattattaata |
36276335 |
T |
 |
| Q |
107 |
tctatgacttaattctgtttcatgccaaaagattattcttatttctgaatgtttgtg---nnnnnnnnnngagtaggcaaatgttagtaagttagtggtt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36276336 |
tctatgacttaattctgtttcatgccaaaagattattctaattcctgaatgtttgtgtttttttttttttgagtaggcaaatgttagtaagttagtggtt |
36276435 |
T |
 |
| Q |
204 |
acattagttttcagggatttcactttggactacac |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
36276436 |
acattagttttcagggatttcactttggactacac |
36276470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 177 - 213
Target Start/End: Original strand, 3523120 - 3523156
Alignment:
| Q |
177 |
taggcaaatgttagtaagttagtggttacattagttt |
213 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3523120 |
taggcaaatcttagtaagttagtggttacattagttt |
3523156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 182 - 218
Target Start/End: Complemental strand, 40114961 - 40114925
Alignment:
| Q |
182 |
aaatgttagtaagttagtggttacattagttttcagg |
218 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
40114961 |
aaatgttagtaagttagtagttacgttagttttcagg |
40114925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University