View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10339_low_17 (Length: 225)
Name: NF10339_low_17
Description: NF10339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10339_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 73 - 202
Target Start/End: Complemental strand, 25321981 - 25321852
Alignment:
| Q |
73 |
tgctgctgttatcaccagattgtttcgctgttccaaaccctcacttgctcaaactcgatggtgcagctttatgtagagaagaagtaggtttagtgactat |
172 |
Q |
| |
|
|||||||| ||| |||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |
|
|
| T |
25321981 |
tgctgctgctataaccagactgtttcgctgttccaaaccttcacttgctcaaactcgatggtgcagctttatgtagagagaaagtaggtttagtgactct |
25321882 |
T |
|
| Q |
173 |
gaaatagtgaatacgtttatgactttatag |
202 |
Q |
| |
|
|||| || ||||| |||| ||| ||||||| |
|
|
| T |
25321881 |
gaaacagcgaatatgtttctgattttatag |
25321852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 73 - 202
Target Start/End: Original strand, 25322232 - 25322361
Alignment:
| Q |
73 |
tgctgctgttatcaccagattgtttcgctgttccaaaccctcacttgctcaaactcgatggtgcagctttatgtagagaagaagtaggtttagtgactat |
172 |
Q |
| |
|
|||||||| ||| ||| || ||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| | |
|
|
| T |
25322232 |
tgctgctgctataaccggactgtttcgctgttccaaaccttcacttgctcaaactcgatggtgcaactttatgtagagagaaagtaggtttagtgactct |
25322331 |
T |
|
| Q |
173 |
gaaatagtgaatacgtttatgactttatag |
202 |
Q |
| |
|
|||| ||||||||| ||| ||| ||||||| |
|
|
| T |
25322332 |
gaaacagtgaatacatttctgattttatag |
25322361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University