View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10339_low_18 (Length: 221)
Name: NF10339_low_18
Description: NF10339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10339_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 18 - 188
Target Start/End: Complemental strand, 7236867 - 7236697
Alignment:
| Q |
18 |
aaaatagcaatatagaagcctgcctataccttaagtaaatggaccgacaaacatcattgaaagtcacgcatcttgagttcgaattttaaataaactatcc |
117 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||||| ||||| |||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7236867 |
aaaatagcaatatagaagcctgcccatgccttaagtaaatggaccaacaaatgtcattgaaagtcacgcgtcttgagttcgaattttaaataaactatcc |
7236768 |
T |
 |
| Q |
118 |
aatcaaacgacatcaatattgtcaattgaattaggctttacaatatatatcttaaatttattttagataca |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7236767 |
aatcaaacgacatcaatattgtcaattgaattaggctttacaatatataccttaaatttattttagataca |
7236697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University