View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10339_low_19 (Length: 211)

Name: NF10339_low_19
Description: NF10339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10339_low_19
NF10339_low_19
[»] chr8 (1 HSPs)
chr8 (6-195)||(41581364-41581553)


Alignment Details
Target: chr8 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 6 - 195
Target Start/End: Complemental strand, 41581553 - 41581364
Alignment:
6 gagaagcaaaggggtcacattgcgaaaccatattttttatttgtatcagtcgtggtcgttttgcttgcgaattagattcattttcctttgtaaacaacaa 105  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
41581553 gagaagcaaaagggtcacattgcgaaaccatattttttatttgtatcagtcgtggtcgttttgcttgcgaattggattcattttcctttgtaaacaacaa 41581454  T
106 ttatgaatttatgatactttatgtatgtgttaagtggcttgacataattgccatagtgatttctatttgtttgcaaatgattgcttgatt 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41581453 ttatgaatttatgatactttatgtatgtgttaagtggcttgacataattgccatagtgatttctatttgtttgcaaatgattgcttgatt 41581364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University