View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10339_low_7 (Length: 363)
Name: NF10339_low_7
Description: NF10339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10339_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 97 - 344
Target Start/End: Original strand, 39918352 - 39918599
Alignment:
| Q |
97 |
ttccaatcatgtccctgttttcacaaaactagcctacgttttaggcttaagagtttctccaaatcatagaagaatgggaatagggctaaaactggtagag |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39918352 |
ttccaatcatgtccctgttttcacaaaactagcctacgttttaggcttaagagtttctccaaatcatagaagaatgggaatagggctaaaactggtagag |
39918451 |
T |
 |
| Q |
197 |
aaaatggaacaatggtttcgtgaaaatggtgctgagtattcttacatggctactgaaaacgacaacgttgcatcagttaaacttttcaccgacaaatgcg |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39918452 |
aaaatggaacaatggtttcgtgaaaatggtgctgagtattcttacatggctactgaaaacgataacgttgcatcagttaaacttttcaccgacaaatgcg |
39918551 |
T |
 |
| Q |
297 |
gttactcaaagttccgtacaccgtcaatccttgttaaccccgttttca |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39918552 |
gttactcaaagttccgtacaccgtcaatccttgttaaccccgttttca |
39918599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 39918256 - 39918303
Alignment:
| Q |
1 |
tgagacagtcggaatgatacgaggttgtatcaaaaccgttacatgcgg |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39918256 |
tgagacagtcggaatgatacgaggttgtatcaaaaccgttacatgcgg |
39918303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 272 - 341
Target Start/End: Complemental strand, 5545517 - 5545448
Alignment:
| Q |
272 |
gttaaacttttcaccgacaaatgcggttactcaaagttccgtacaccgtcaatccttgttaaccccgttt |
341 |
Q |
| |
|
|||||||| ||||| || ||||||||||| |||||||||||||||||||||| || || |||||||||| |
|
|
| T |
5545517 |
gttaaactcttcactgaaaaatgcggttatacaaagttccgtacaccgtcaattctcgtcaaccccgttt |
5545448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University