View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10339_low_9 (Length: 328)
Name: NF10339_low_9
Description: NF10339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10339_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 9e-98; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 9e-98
Query Start/End: Original strand, 7 - 210
Target Start/End: Original strand, 28718066 - 28718270
Alignment:
| Q |
7 |
aaaacatacttcaaagtatattgaattggcaaaatttagtagttttagaagttaccacaagatgtgacatagtgagttgcttatttatgtctta-tacat |
105 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
28718066 |
aaaacatatttcaaagtatattgaattggcaaaatttagtagttttagaagttaccacaagatgtgacatagtgagttgcttatttacgtcttaatacat |
28718165 |
T |
|
| Q |
106 |
aaatttaatgtagtacgtatgattaaaatggtaatgtgcaatatactaatttgttgacatttatgttggttagcattttccgaaccgtgtgtctagagag |
205 |
Q |
| |
|
|| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28718166 |
aattttaatgtagtacatatgattaaaatggtaatgtgcaatatactaatttgttgacatttatgttggttagcattttccgaaccgtgtgtctagagag |
28718265 |
T |
|
| Q |
206 |
gtttt |
210 |
Q |
| |
|
||||| |
|
|
| T |
28718266 |
gtttt |
28718270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 209 - 318
Target Start/End: Original strand, 28718752 - 28718861
Alignment:
| Q |
209 |
ttcccaacaagacctaactaatttatatttcaaatctctatattgtcagatacccaatcaatcaaacgtaacattactcccactccaacccatcacaact |
308 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
28718752 |
ttcccaacaagacctaactaatttttatttcaaatctctatattgtcagatactcaatcaatcaaacataacactactcccactccaacccatcacaact |
28718851 |
T |
|
| Q |
309 |
tcaatctctg |
318 |
Q |
| |
|
|||||||||| |
|
|
| T |
28718852 |
tcaatctctg |
28718861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 234 - 311
Target Start/End: Original strand, 13056319 - 13056398
Alignment:
| Q |
234 |
tatttcaaatctctatattgtcagatacccaatcaatc--aaacgtaacattactcccactccaacccatcacaacttca |
311 |
Q |
| |
|
|||||||||||||| || |||||||| |||||||||| |||| ||||| |||| |||||| ||||||||||||||||| |
|
|
| T |
13056319 |
tatttcaaatctctggatcgtcagatatccaatcaatcaaaaacataacactactaccactctaacccatcacaacttca |
13056398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University