View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1033_low_5 (Length: 206)
Name: NF1033_low_5
Description: NF1033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1033_low_5 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 35762345 - 35762286
Alignment:
| Q |
1 |
tatggtggataaaaacactacaatgtattaccaatttggtgtaggaaacaagtaatatag |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35762345 |
tatggtggataaaaacactacaatgtattaccaatttggtgtaggaaacaagtaatatag |
35762286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 169 - 206
Target Start/End: Complemental strand, 48286355 - 48286318
Alignment:
| Q |
169 |
gttggaagcggtttttgttggatgtttgggtatctata |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48286355 |
gttggaagcggtttttgttggatgtttgggtctctata |
48286318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University