View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1033_low_5 (Length: 206)

Name: NF1033_low_5
Description: NF1033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1033_low_5
NF1033_low_5
[»] chr4 (1 HSPs)
chr4 (1-60)||(35762286-35762345)
[»] chr7 (1 HSPs)
chr7 (169-206)||(48286318-48286355)


Alignment Details
Target: chr4 (Bit Score: 60; Significance: 9e-26; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 35762345 - 35762286
Alignment:
1 tatggtggataaaaacactacaatgtattaccaatttggtgtaggaaacaagtaatatag 60  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35762345 tatggtggataaaaacactacaatgtattaccaatttggtgtaggaaacaagtaatatag 35762286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 169 - 206
Target Start/End: Complemental strand, 48286355 - 48286318
Alignment:
169 gttggaagcggtttttgttggatgtttgggtatctata 206  Q
    ||||||||||||||||||||||||||||||| ||||||    
48286355 gttggaagcggtttttgttggatgtttgggtctctata 48286318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University