View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10341_high_2 (Length: 480)
Name: NF10341_high_2
Description: NF10341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10341_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 257 - 445
Target Start/End: Original strand, 42983132 - 42983320
Alignment:
| Q |
257 |
ccgatggaacttccaaaactgaatccgggtcatcgaacaaggtatcccatttagcggaatcagaggggagaacttcaaaaagaatcgattttgataaatg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42983132 |
ccgatggaacttccaaaactgaatccgggtcatcgaacaaggtatcccatttagcggaatcagaggggagaacttcaaaaagaatcgattttgataaatg |
42983231 |
T |
|
| Q |
357 |
ggtcgggctaattgggtcgggttgtgaaggagaattatcagaaagtttggttttttggttgtgtttgtggggtttggagaagcgtttgt |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42983232 |
ggtcgggctaattgggtcgggttgtgaaggagaattatcagaaagtttggttttttggttgtgtttgtggggtttggagaagcgtttgt |
42983320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 141; E-Value: 1e-73
Query Start/End: Original strand, 37 - 181
Target Start/End: Original strand, 42982912 - 42983056
Alignment:
| Q |
37 |
acctgtggcagagtcaatttcttggattcattacttttaacaagctcatcatattgcagtttaatttttctctgcaaaacgctacttgaagaagtaaacg |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42982912 |
acctgtggcagagtcaatttcttggattcattacttttaacaagctcatcatattgcagtttaatttttctctgcaaaacgctacttgaagaagtaaacg |
42983011 |
T |
|
| Q |
137 |
gatacatgcaatcagactcaagcttcacacccgaatcaaaacccg |
181 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42983012 |
gatacatgcaatcagattcaagcttcacacccgaatcaaaacccg |
42983056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University