View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10341_high_7 (Length: 250)
Name: NF10341_high_7
Description: NF10341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10341_high_7 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 102 - 250
Target Start/End: Original strand, 1036770 - 1036918
Alignment:
| Q |
102 |
agtatgatacaatagcgtagtaaatcaaatcttataaacatttcaacttgatcatgattcaacactagagtttcacaagcttgttctacaatatcttttg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1036770 |
agtatgatacaatagcgtagtaaatcaaatcttataaacatttcaacttgatcatgattcaacactagagtttcacaagcttgttgtacaatatcttttg |
1036869 |
T |
 |
| Q |
202 |
aaatgaaatatatcaataagaaaccatgtcaattgaaatagatcatgcc |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1036870 |
aaatgaaatatatcaataagaaaccatgtcaattgaaatagatcatgcc |
1036918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Original strand, 1036669 - 1036710
Alignment:
| Q |
1 |
gcaatagatgatttatgcacaagataatgtaaactcactgta |
42 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
1036669 |
gcaatagatgaattatgcacaagataatgtaaagtcactgta |
1036710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University