View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10341_low_13 (Length: 292)
Name: NF10341_low_13
Description: NF10341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10341_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 268; Significance: 1e-150; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 268; E-Value: 1e-150
Query Start/End: Original strand, 1 - 276
Target Start/End: Original strand, 16830132 - 16830407
Alignment:
| Q |
1 |
acaaaaaatagcatcacattcaaatgaaaagaatccattacctatttcatttctttggataggttttcagtatttatttcttggttcagctgatcttttc |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16830132 |
acaaaaaatagcatcacactcaaatgaaaaaaatccattacctatttcatttctttggataggttttcagtatttatttcttggttcagctgatcttttc |
16830231 |
T |
 |
| Q |
101 |
acattggctggattactggaatttttcttctcagaagcaccttcaagtatgagatcattagcaacatcactttcttgggcttctttggcaatgggatatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16830232 |
acattggctggattactggaatttttcttctcagaagcaccttcaagtatgagatcattagcaacatcactttcttgggcttctttggcaatgggatatt |
16830331 |
T |
 |
| Q |
201 |
accttagttcagtgattgtttctatagtaaacagtgttactggtaatggtagtcataaaccatggttaagtgggtc |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16830332 |
accttagttcagtgattgtttctatagtaaacagtgttactggtaatggtagtcataaaccatggttaagtgggtc |
16830407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 65 - 247
Target Start/End: Complemental strand, 25170351 - 25170169
Alignment:
| Q |
65 |
tttcagtatttatttcttggttcagctgatcttttcacattggctggattactggaatttttcttctcagaagcaccttcaagtatgagatcattagcaa |
164 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||| ||||||| || |||||||||||||| |||||||||| | |||||||| | || | |
|
|
| T |
25170351 |
tttcagtacttgtttcttggttcagctgatcttttcactatggctggtttgttggaatttttcttcacagaagcaccaattaaaatgagatcttgggcta |
25170252 |
T |
 |
| Q |
165 |
catcactttcttgggcttctttggcaatgggatattaccttagttcagtgattgtttctatagtaaacagtgttactggtaat |
247 |
Q |
| |
|
|||||||| ||||||||||||||||| | || ||||| | |||||||||||| | || ||||| || ||||||||||||||| |
|
|
| T |
25170251 |
catcacttacttgggcttctttggcattaggttattatttaagttcagtgattatatcaatagttaatagtgttactggtaat |
25170169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 83 - 200
Target Start/End: Original strand, 44613203 - 44613320
Alignment:
| Q |
83 |
ggttcagctgatcttttcacattggctggattactggaatttttcttctcagaagcaccttcaagtatgagatcattagcaacatcactttcttgggctt |
182 |
Q |
| |
|
||||||||||||||||| ||||||||||| | |||| ||||||||| | || ||||||| |||||||| || ||||| ||||||||||| ||||||| |
|
|
| T |
44613203 |
ggttcagctgatctttttacattggctggtatgatggagtttttcttcactgaggcaccttggagtatgaggtctttagctacatcactttcatgggctt |
44613302 |
T |
 |
| Q |
183 |
ctttggcaatgggatatt |
200 |
Q |
| |
|
| ||||| |||||||||| |
|
|
| T |
44613303 |
cattggctatgggatatt |
44613320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University