View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10341_low_15 (Length: 250)
Name: NF10341_low_15
Description: NF10341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10341_low_15 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 8 - 250
Target Start/End: Complemental strand, 1037216 - 1036974
Alignment:
| Q |
8 |
aagcaaaggatctgcctcagttgaaacttttccttcaaagaaaacatacaaagataagggaaaggaaatgattaatgataaatttggtgatcatgatgag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1037216 |
aagcaaaggatctgcctcagttgaaacttttcctccaaagaaaacatacaaagagaagggaaaggaaatgattaatgataaatttggtgatcatgatgag |
1037117 |
T |
|
| Q |
108 |
aaaaagattcttgaatcaacaaggacaagaatcaaagacatggctttatccactactcaagctgtaaccagttatgcaaagaggttcagtgaagaagata |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1037116 |
aaaaagattcttgaatcaacaaggacaagaatcaaagacatggctctatccactactcaagctgtaaccagttatgcaaagaggttcagtgaagaagata |
1037017 |
T |
|
| Q |
208 |
aacaaaagctaatatacactggtgcaacaattcttgtggttgc |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1037016 |
aacaaaagctaatatacactggtgcaacaattcttgtggttgc |
1036974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University