View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10341_low_6 (Length: 402)
Name: NF10341_low_6
Description: NF10341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10341_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 4e-63; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 16 - 167
Target Start/End: Original strand, 29007579 - 29007732
Alignment:
| Q |
16 |
agctattaggtcggtgaatgaagtcataaactgaccctattttagttactttgtgtagccgcgttcatagtgactcatcaaatgcgtgtccctttcactc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29007579 |
agctattaggtcggtgaatgaagtcataaactgaccctattttagttactttgtgtagccgcgttcatagtgactcaccaaatgcgtgtccctttcacta |
29007678 |
T |
|
| Q |
116 |
attcttatccatcaat--aaaaaatcactttttcaaaaattaatgctgacctgt |
167 |
Q |
| |
|
|||| ||||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
29007679 |
attcctatccatcaataaaaaaaatacctttttcaaaaattaatgctgacctgt |
29007732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 233 - 313
Target Start/End: Original strand, 29007798 - 29007878
Alignment:
| Q |
233 |
atcaccctcctctcattttcctttgtcaatttgttttgtactttacccttctcatatctcaaaatcatataccatatatgg |
313 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29007798 |
atcaccctcctctcattttcctatgtcaatttgttttgtactttacccttctcatttctcaaaatcatataccatatatgg |
29007878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 351 - 387
Target Start/End: Original strand, 29007916 - 29007952
Alignment:
| Q |
351 |
ctcagccactgcttgtgatcgttgcttgcatcaatcc |
387 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29007916 |
ctcagccactgcttgtgatcgttgcttgcatcaatcc |
29007952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University