View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10342_high_18 (Length: 369)
Name: NF10342_high_18
Description: NF10342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10342_high_18 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 8 - 369
Target Start/End: Original strand, 7313787 - 7314149
Alignment:
| Q |
8 |
gagcagagaaatccaacatataaaagagcnnnnnnntccattaaaattggcattggtggtttatacctagaaaatcaacaataaaatcattattacaatg |
107 |
Q |
| |
|
||||||| ||||||||||||| ||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7313787 |
gagcagaaaaatccaacatatgaaagagcaaaaaaatccattaaaattggcattagtggtttatacctagaaaatcaacaataaaatcattattacaatg |
7313886 |
T |
|
| Q |
108 |
tttagaggtttgcaaaaataaaaacaaagttatctttaagtatcaggatcaaatcaatttccattctttcttgatatccaaaacnnnnnnnccaaatcaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
7313887 |
tttagaggtttgcaaaaataaaaacaaagttatctttaagcatcaggatcaaatcaatttccattctttcttgatatccaaaacaaaaaaaccagatcaa |
7313986 |
T |
|
| Q |
208 |
gggtttcacgttgagctgcaatcatctcacgcatttgtaaaggcaaattagctattgtacacgttagtgaacaaattaatcatg-tagtttcagcaatac |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7313987 |
gggtttcacgttgagctgcaatcatctcacgcatttgtaaaggcaaattagctattgtacatattagtgaacaaattaatcatgttagtttcagcaatac |
7314086 |
T |
|
| Q |
307 |
ctgattgagggtttgcgaggattcaactatgggttcgcaacagatgacgggtttgcggaggat |
369 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
7314087 |
ctgattgagggtttgcgaggattcaactatgggttcacaacggatgacgggtttgcggaggat |
7314149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 53 - 88
Target Start/End: Complemental strand, 32091300 - 32091265
Alignment:
| Q |
53 |
attggcattggtggtttatacctagaaaatcaacaa |
88 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32091300 |
attggcattagtggtttatacctagaaaatcaacaa |
32091265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University