View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10342_high_20 (Length: 340)
Name: NF10342_high_20
Description: NF10342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10342_high_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 1 - 322
Target Start/End: Complemental strand, 52544290 - 52543969
Alignment:
| Q |
1 |
ggttgtattggtgtagagttattcaacttgttgtattcatcttcttgtcgatgctctagttgctgtcaaacacctgaaggactcttgtgaggtttatgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52544290 |
ggttgtattggtgtagagttattcaacttgttgtattcatcttcttgtggatgctctagttgttgtcaaacacctgaaggactcttgtgaggtttatgta |
52544191 |
T |
 |
| Q |
101 |
aatgattggagcacattagaaggttgctcgcaatgatattgctttgattttatttgagcattgttcttctctttacttgttaaacgcattggattaacac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
52544190 |
aatgattggagcacattagaaggttgctcgcaatgatattgctttgattttatttgaacattgttcttctctttactggttaaacgcattggattaacac |
52544091 |
T |
 |
| Q |
201 |
tatgcatttaattgctttgtagttttctttcttgagttcaacccttttttatccaaaaagaccggagaggatagagccattgatgcagaaaaatgaataa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52544090 |
tatgcatttaattgctttgtagttttctttcttgagttcaacccttttttatccaaaaagaccggagaggatagagccattgatgcagaaaaatgaataa |
52543991 |
T |
 |
| Q |
301 |
gctatcacaacgtatccgtgtt |
322 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
52543990 |
gctatcacaacgtatccgtgtt |
52543969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University