View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10342_high_33 (Length: 263)
Name: NF10342_high_33
Description: NF10342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10342_high_33 |
 | |
|
| [»] scaffold0372 (1 HSPs) |
| |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0372 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: scaffold0372
Description:
Target: scaffold0372; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 263
Target Start/End: Original strand, 3742 - 4000
Alignment:
| Q |
1 |
gtgacagtgctgttatgtggcactagcggatgtggaaaatcgacgttgtctgcaatactggtatacttctttacagaaatagttatttgttagttatagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3742 |
gtgacagtgctgttatgtggcactagcggatgtggaaaatcgacgttgtctgcaatactggtatacttctttacagaaatagttatttgtta----tagt |
3837 |
T |
|
| Q |
101 |
ttttacttatttcgtggtaggatatgcaaatgtttaatgaagtataaaactactattgttgcagttcaataatggtttcatttatttatatcttcacttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3838 |
ttttacttatttcgtggtaggatatgcaagtgtttaatgaagtataaaactactattgttgcagttcaataatggtttcatttatttatatcttcacttc |
3937 |
T |
|
| Q |
201 |
agggtagcagattgggaatcacgacagttgtatcaacggattccattaggcacatgatgagaa |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3938 |
agggtagcagattgggaatcacgacagttgtatcaacggattccattaggcacatgatgagaa |
4000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 21447794 - 21447536
Alignment:
| Q |
1 |
gtgacagtgctgttatgtggcactagcggatgtggaaaatcgacgttgtctgcaatactggtatacttctttacagaaatagttatttgttagttatagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21447794 |
gtgacagtgctgttatgtggcactagcggatgtggaaaatcgacgttgtctgcaatactggtatacttctttacagaaatagttatttgtta----tagt |
21447699 |
T |
|
| Q |
101 |
ttttacttatttcgtggtaggatatgcaaatgtttaatgaagtataaaactactattgttgcagttcaataatggtttcatttatttatatcttcacttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21447698 |
ttttacttatttcgtggtaggatatgcaagtgtttaatgaagtataaaactactattgttgcagttcaataatggtttcatttatttatatcttcacttc |
21447599 |
T |
|
| Q |
201 |
agggtagcagattgggaatcacgacagttgtatcaacggattccattaggcacatgatgagaa |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21447598 |
agggtagcagattgggaatcacgacagttgtatcaacggattccattaggcacatgatgagaa |
21447536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 183 - 262
Target Start/End: Original strand, 40685001 - 40685080
Alignment:
| Q |
183 |
tatttatatcttcacttcagggtagcagattgggaatcacgacagttgtatcaacggattccattaggcacatgatgaga |
262 |
Q |
| |
|
|||||||||||| ||||||||| || | |||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40685001 |
tatttatatctttacttcagggaagtcggctgggaatcacaacagttgtatcaactgattccattaggcacatgatgaga |
40685080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University