View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10342_high_46 (Length: 241)

Name: NF10342_high_46
Description: NF10342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10342_high_46
NF10342_high_46
[»] chr4 (1 HSPs)
chr4 (139-211)||(10425253-10425325)


Alignment Details
Target: chr4 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 139 - 211
Target Start/End: Complemental strand, 10425325 - 10425253
Alignment:
139 tatagattgtctctattgggtctgtttgtacaacaattttgtatgactatcaaataagaaatttgtttctttg 211  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
10425325 tatagattgtctctattgggtctgtttgtacaacaattttgtatgactatcaaagaagaaatttgtttctttg 10425253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University