View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10342_high_50 (Length: 238)
Name: NF10342_high_50
Description: NF10342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10342_high_50 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 30020339 - 30020563
Alignment:
| Q |
1 |
cttgatcaagttattgcagcagaccccaa-cacaagatccaacactatataccaagaaataatcgggtgttttgcggtcttgggtttgtacttgcactcc |
99 |
Q |
| |
|
|||| |||||||||||||||||| ||||| |||||| |||||||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30020339 |
cttggtcaagttattgcagcagatcccaaacacaagctccaacaccatatatcaagaaataatcgggtgttttgctgtcttgggtttgtacttgcactcc |
30020438 |
T |
 |
| Q |
100 |
tcacattttattgggtaaatgatgttatatacgtagaaaaattacgtggagttgttcatattagttccacaaacgt-aaaaaagaagtttggttcacaat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | |||||| |||||||||||||||| |
|
|
| T |
30020439 |
tcacattttattgggtaaatgatgttatatacgtagaaaaattacgtggagttgttcatattagtttcacaaacctaaaaaaaaaagtttggttcacaat |
30020538 |
T |
 |
| Q |
199 |
aaagtacgaaaaccacaagctcttt |
223 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
30020539 |
aaagtacgaaaaccacaagctcttt |
30020563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 42779910 - 42779865
Alignment:
| Q |
1 |
cttgatcaagttattgcagcagaccccaacacaagatccaacacta |
46 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42779910 |
cttggtcaagttattgcagcagaccccaacacaaattccaacacta |
42779865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 2022674 - 2022631
Alignment:
| Q |
1 |
cttgatcaagttattgcagcaga-ccccaacacaagatccaaca |
43 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
2022674 |
cttgatcaagttattgcagcagacccccaacacaagttccaaca |
2022631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 6 - 35
Target Start/End: Complemental strand, 43378147 - 43378118
Alignment:
| Q |
6 |
tcaagttattgcagcagaccccaacacaag |
35 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43378147 |
tcaagttattgcagcagaccccaacacaag |
43378118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University