View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10342_high_53 (Length: 229)
Name: NF10342_high_53
Description: NF10342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10342_high_53 |
 |  |
|
| [»] chr5 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 7e-70; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 65 - 229
Target Start/End: Original strand, 29666225 - 29666390
Alignment:
| Q |
65 |
tttttcctttacatgatctttttgaaagatcctttgcatgtcatgtgtcaaaagaaaataactgcccggtttcatnnnnnnnn-ccacggcttatcgtat |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29666225 |
tttttcctttacatgatctttttgaaagatcctttgcatgtcatgtgtcaaaagaaaataactgcccggtttcataaaaaaaaaccacggcttatcgtat |
29666324 |
T |
 |
| Q |
164 |
ttcaatctgcacgtcataattttcccacttaccttcactctcccttttttatttcaaacctaatac |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29666325 |
ttcaatctgcacgtcataattttcccacttaccttcactctcccttttttatttcaaacctaatac |
29666390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 40 - 73
Target Start/End: Original strand, 29665786 - 29665819
Alignment:
| Q |
40 |
gaatatagatgatgtatcggtaccatttttcctt |
73 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
29665786 |
gaatatagataatgtatcggtaccatttttcctt |
29665819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 37
Target Start/End: Complemental strand, 9589242 - 9589210
Alignment:
| Q |
5 |
cactcatatgtttgggtgtaccatagaatttgc |
37 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
9589242 |
cactcatatctttgggtgtaccatagaatttgc |
9589210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 37
Target Start/End: Original strand, 34902027 - 34902059
Alignment:
| Q |
5 |
cactcatatgtttgggtgtaccatagaatttgc |
37 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
34902027 |
cactcaaatgtttgggtgtaccatagaatttgc |
34902059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 5 - 37
Target Start/End: Complemental strand, 42974928 - 42974896
Alignment:
| Q |
5 |
cactcatatgtttgggtgtaccatagaatttgc |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42974928 |
cactcatatgtttgggtgtaccatagaatttgc |
42974896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 37
Target Start/End: Original strand, 45857847 - 45857879
Alignment:
| Q |
5 |
cactcatatgtttgggtgtaccatagaatttgc |
37 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
45857847 |
cactcatatctttgggtgtaccatagaatttgc |
45857879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 37
Target Start/End: Complemental strand, 2273043 - 2273011
Alignment:
| Q |
5 |
cactcatatgtttgggtgtaccatagaatttgc |
37 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
2273043 |
cactcatatctttgggtgtaccatagaatttgc |
2273011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 37
Target Start/End: Complemental strand, 11446769 - 11446737
Alignment:
| Q |
5 |
cactcatatgtttgggtgtaccatagaatttgc |
37 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
11446769 |
cactcatatctttgggtgtaccatagaatttgc |
11446737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 37
Target Start/End: Original strand, 18425491 - 18425523
Alignment:
| Q |
5 |
cactcatatgtttgggtgtaccatagaatttgc |
37 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
18425491 |
cactcatatctttgggtgtaccatagaatttgc |
18425523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 37
Target Start/End: Complemental strand, 12547397 - 12547365
Alignment:
| Q |
5 |
cactcatatgtttgggtgtaccatagaatttgc |
37 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
12547397 |
cactcatatctttgggtgtaccatagaatttgc |
12547365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University