View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10342_low_10 (Length: 425)
Name: NF10342_low_10
Description: NF10342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10342_low_10 |
 | |
|
| [»] chr1 (3 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 7e-62; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 274 - 425
Target Start/End: Original strand, 50909285 - 50909430
Alignment:
| Q |
274 |
ataatttgcacagtaaaaggtccaaaataagtttcttccttcagcaacaacacaacagatcaggtaagagaattagtaaaaactagtcaactgcttgctt |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50909285 |
ataatttgcacagtaaaaggtccaaaataagtttcttccttcagcaacaacacaacagatcaggtaagagaattagtaaaaactagtcaactgcttgc-- |
50909382 |
T |
|
| Q |
374 |
gcacacatagaaaatgtggtctccacttgtttgaacttgagattcagcatag |
425 |
Q |
| |
|
||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
50909383 |
----acacagaaaatgtggtctcaacttgtttgaacttgagattcagcatag |
50909430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 184 - 275
Target Start/End: Original strand, 50908846 - 50908938
Alignment:
| Q |
184 |
aaatggtgaagaaccatccagttgtgctactattgctcaagagataaacattgataaaccgccccatgtccagatcaattag-aagggaagat |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
50908846 |
aaatggtgaagaaccatccagttgtgctactattgctcaagagataaacattgataaaccgccccatgtccagatcaattagaaagggaagat |
50908938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 33 - 100
Target Start/End: Complemental strand, 50996768 - 50996701
Alignment:
| Q |
33 |
tatataactaaccttctcaatcgcaattagttgacctgtctcttgccctcttatctttggcagcctgt |
100 |
Q |
| |
|
|||||||| |||||||||||| ||| ||||| || ||||||||||| | ||||||||||||||||| |
|
|
| T |
50996768 |
tatataacaaaccttctcaatagcatatagttaacttgtctcttgccattgtatctttggcagcctgt |
50996701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University