View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10342_low_20 (Length: 370)
Name: NF10342_low_20
Description: NF10342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10342_low_20 |
 |  |
|
| [»] scaffold0039 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0039 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 1 - 360
Target Start/End: Original strand, 23611 - 23970
Alignment:
| Q |
1 |
agatccatgatttcaatgctttttcttggtcacctcaatgaccttgcactagctggtgggtcccttgctattggttttgccaacatcactggttactcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23611 |
agatccatgatttcaatgctttttcttggtcacctcaatgaccttgcactagctggtgggtcccttgctattggttttgccaacatcactggttactcca |
23710 |
T |
 |
| Q |
101 |
ttctttctggtcttgctgttggtatggaaccaatttgtggtcaagcttttggtgctaaaaaattcactcttcttggtctttgtcttcaaagaaccattct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23711 |
ttctttctggtcttgctgttggtatggaaccaatttgtggtcaagcttttggtgctaaaaaattcactcttcttggtctttgtcttcaaagaaccattct |
23810 |
T |
 |
| Q |
201 |
tttgcttcttttggtttcaatgccaatatctttttcatggctttacatgnnnnnnntgcttttgttttttaaccaagatgaagaaatagcaacaatggct |
300 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23811 |
tttgcttcttttggtttcaataccaatatctttttcatggctttacatgaaaaaaatgcttttgttttttaaccaagatgaagaaatagcaacaatggct |
23910 |
T |
 |
| Q |
301 |
caaacttatattctatattcaattcctgatcttattgctcaatcctttattcaccctttg |
360 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23911 |
caaacttatattctatattcaattcctgatcttattgctcaatcctttatacaccctttg |
23970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 65; Significance: 2e-28; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 50 - 166
Target Start/End: Original strand, 2989796 - 2989912
Alignment:
| Q |
50 |
tagctggtgggtcccttgctattggttttgccaacatcactggttactccattctttctggtcttgctgttggtatggaaccaatttgtggtcaagcttt |
149 |
Q |
| |
|
|||| |||||||| ||||| ||||| ||||| |||||||| |||||||||||||| ||||||||||| | || |||||||| ||||||||||||||||| |
|
|
| T |
2989796 |
tagcaggtgggtcacttgccattggatttgcaaacatcacaggttactccattctctctggtcttgccatgggaatggaacctatttgtggtcaagcttt |
2989895 |
T |
 |
| Q |
150 |
tggtgctaaaaaattca |
166 |
Q |
| |
|
||||||||||| ||||| |
|
|
| T |
2989896 |
tggtgctaaaagattca |
2989912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 76 - 206
Target Start/End: Complemental strand, 45846431 - 45846301
Alignment:
| Q |
76 |
tttgccaacatcactggttactccattctttctggtcttgctgttggtatggaaccaatttgtggtcaagcttttggtgctaaaaaattcactcttcttg |
175 |
Q |
| |
|
||||| ||||| || |||||||| || || || ||||| || ||||| |||||||| |||||||| |||||||||||||| |||| ||||||||| |||| |
|
|
| T |
45846431 |
tttgcgaacattaccggttactcaatcctctccggtctcgccgttggaatggaacctatttgtggacaagcttttggtgcaaaaagattcactctccttg |
45846332 |
T |
 |
| Q |
176 |
gtctttgtcttcaaagaaccattcttttgct |
206 |
Q |
| |
|
|||| ||| | |||| ||||||||| ||||| |
|
|
| T |
45846331 |
gtctatgtttacaaaaaaccattctcttgct |
45846301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University