View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10342_low_22 (Length: 362)
Name: NF10342_low_22
Description: NF10342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10342_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 3e-67; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 18 - 155
Target Start/End: Complemental strand, 54864731 - 54864595
Alignment:
| Q |
18 |
ccatcgaccattgttcacattaactttaaagcgattatcatccaattaagtaggggcttggtgaataggatcatcatgctagaaattgaccaggatcgac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
54864731 |
ccatcgaccattgttcacattaactttaaagcgattatcatccaattaagtaggggcttggtgaatag-atcatcatgctagaaattgaccaggatcgac |
54864633 |
T |
|
| Q |
118 |
cattgttcttataatactaaaggccagtgacattgctt |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54864632 |
cattgttcttataatactaaaggccagtgacattgctt |
54864595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 270 - 354
Target Start/End: Complemental strand, 54864594 - 54864509
Alignment:
| Q |
270 |
caactccccaatctct-aagataatgcataatttgtctcaggagcttgcatgaaaagaggacaatagtacctctaatcttcttctc |
354 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54864594 |
caactccccaatctcttaagataatgcataatttgtctcaggagcttgcatgaaaagaggacaatagtacctctaatcttcttctc |
54864509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University