View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10342_low_31 (Length: 310)
Name: NF10342_low_31
Description: NF10342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10342_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 9 - 303
Target Start/End: Original strand, 4934648 - 4934945
Alignment:
| Q |
9 |
agaagcaaaggtgcatgctttgtttgtttcgccttttggttttgttcacaacatctatatgtttgatctgctgcaattttttagttttattgccaattgc |
108 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4934648 |
agaagaaaaggtgcatactttgtttgtttcgccttttggttttgttcacaacatctatatgtttgatctgctgcaattttttagttttattgccaattgc |
4934747 |
T |
|
| Q |
109 |
aatggattagttagtttttacatgcaaatctgtatannnnnnnnnnnnnnnnnnnnngtt---gatattatgtttcctttcaggttcatacttcttacta |
205 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4934748 |
aatggattagttagttttgacatgcaaatctgtatatttttttagtttttagtttttgttgttgatattatgtttcctttcaggttcatacttcttacta |
4934847 |
T |
|
| Q |
206 |
tgtatctattccaaaacaaactcagtggagtgaatgagttggcatgcattgtaacttgttgtctagtgtagcttagagattaggttcctgcacaggtt |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4934848 |
tgtatctattccaaaacaaactcagtggagtgaatgagttggcatgcattgtaacttgttgtctagtgtagcttagagattaggttcctgtacaggtt |
4934945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University