View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10342_low_32 (Length: 307)
Name: NF10342_low_32
Description: NF10342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10342_low_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 284
Target Start/End: Original strand, 50530157 - 50530440
Alignment:
| Q |
1 |
agaaaccggcaatggcgtaagatagaacaacggaagggccagcgtgaacacgggtagcgtggccagtggtgacgaagactccggcgccgaccattccacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50530157 |
agaaaccggcaatggcgtaagatagaacaacggaagggccagcgtgaacacgggtagcgtggccagtggtgacgaagactccggcgccgaccattccacc |
50530256 |
T |
 |
| Q |
101 |
gataccaaagctgactaagtcaaaccaacggagggttttgcgcatgctgttaccggacctagctcgaacgcggctcatttcttcgtaagaagtggagacg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
50530257 |
gataccaaagctgactaagtcaaaccaacggaggcttttgcgcatgctgttgccggacctagctcgaacacggctcatttcttcgtaagaagtggagacg |
50530356 |
T |
 |
| Q |
201 |
gagaagccgcgacgagcaaagcgagagggagttttagcgacggcttggagatagtttgggaggctcgaaaacgatgagccatgg |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50530357 |
gagaagccgcgacgagcaaagcgagagggagttttagcgacggcttggagatagtttgggaggctcgaaaacgatgagccatgg |
50530440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University