View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10342_low_33 (Length: 302)
Name: NF10342_low_33
Description: NF10342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10342_low_33 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 18 - 291
Target Start/End: Complemental strand, 42177955 - 42177684
Alignment:
| Q |
18 |
caatggtccctctccctatcacctttgtcattttgctttgattccaaagctaccaccgccaaggaaacaccgactttgcaacctaaataaaacattttag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42177955 |
caatggtccctctccctatcacctttgtcattttgctttgattccaaagctaccaccgccaaggaaacaccgactttgtaacctaaataaaacattttag |
42177856 |
T |
|
| Q |
118 |
ttattttactttctagcttggattattcccttttgcctactctaattcaataatgtattgtggaactttgctttcccnnnnnnnnngaaggaccatgtct |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
42177855 |
ttattttactttctagcttggattattcccttttgcctactctaattcaataatgtattgtggaactttgctttccc--aaaaaaagaaggaccgtgtct |
42177758 |
T |
|
| Q |
218 |
atttatatcatctctacatatgggtttccacctcgttataattttttggttagaaataaagatggtggattcat |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42177757 |
atttatatcatctctacatatgggtttccacctcgttataattttttggttagaaataaagatggtggattcat |
42177684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University