View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10342_low_34 (Length: 285)
Name: NF10342_low_34
Description: NF10342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10342_low_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 8e-98; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 15 - 203
Target Start/End: Complemental strand, 6562322 - 6562134
Alignment:
| Q |
15 |
acaattttcttactaaccaaacatcatcaactttctcggtgagattccttgtcactaactaacaatgttgttgttttctacttccatttttagtgttgac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6562322 |
acaattttcttactaaccaaacatcatcaactttctcggtgagattccttgtcactaactaacaatgttgttgttttctacttccatttttagtgttgac |
6562223 |
T |
|
| Q |
115 |
tttgtttttgccgtgtttagtagtattcattttctgggctaatgacaagttacagtctttgatgataatgtagccataactagctaccc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
6562222 |
tttgtttttgccgtgtttagtagtattcattttctgggctaatgacaagttacaatctttgatgataatgtagccataactagccaccc |
6562134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 234 - 274
Target Start/End: Complemental strand, 6562103 - 6562063
Alignment:
| Q |
234 |
cttcttcactaaagtgtgatttttcatatgatgtgtttcat |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6562103 |
cttcttcactaaagtgtgatttttcatatgatgtgtttcat |
6562063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University