View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10342_low_43 (Length: 258)
Name: NF10342_low_43
Description: NF10342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10342_low_43 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 9818331 - 9818087
Alignment:
| Q |
1 |
tgaatatgaggctcaaatttgtcatgtttgatgatgaataagaaacagaagtatgcacaacaatgtcgcacttggcataatgtatgnnnnnnnnnnnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9818331 |
tgaatatgaggctcaaatttgtcatgtttgatgatgaataagaaacagaagtatgcacaacaatgtcgcacttggcataatgtatgaaaaataaaaaata |
9818232 |
T |
 |
| Q |
101 |
n-----tactgaagctaacaaatcaaaacttcaggttcattttagttttgaacacatcaaaatccaaacttaaggttcatttaagtttctgttgtccatt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9818231 |
aaaaaatactgaagctaacaaatcaaaacttcaggttcattttagttttgaacacatcaaaatccaaacttaaggtttatttaagtttctgttgtccatt |
9818132 |
T |
 |
| Q |
196 |
cgcttttcactcaacaacaaatcgctaccatagtcaagttcatcg |
240 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9818131 |
cgcttttcactcaacaacaaatcgataccatagtcaagttcatcg |
9818087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University