View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10342_low_54 (Length: 245)
Name: NF10342_low_54
Description: NF10342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10342_low_54 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 73 - 235
Target Start/End: Complemental strand, 7248307 - 7248145
Alignment:
| Q |
73 |
gcagaacttgtttgtattgtttagattagaagagactaacctggaggaggaagaagttttttggtgaaaaatctcttctttgtgagtctactattccaat |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7248307 |
gcagaacttgtttgtattgtttagattagaagagactaaccaggaggaggaagaagttttttggtgaaaaatctcttctttgtgagtctactattccaat |
7248208 |
T |
|
| Q |
173 |
caaatagctgagagaaaattccaatacaaccaccacctagcttttgattattcttcttctctg |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7248207 |
caaatagctgagagaaaattccaatacaaccaccacctagcttttgattattcttcttctctg |
7248145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University