View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10342_low_58 (Length: 239)
Name: NF10342_low_58
Description: NF10342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10342_low_58 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 8447264 - 8447491
Alignment:
| Q |
1 |
atgtcgtgatcttgatatgcaggtacttgaccaaatggctgaaaattaaacaagcaatgtgaaaa-ttatgatgatgactaacataacaacaaggtagaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| ||||||||||| |
|
|
| T |
8447264 |
atgtcgtgatcttgatatgcaggtacttgaccaaatggctgaaaattaaacaagcaatgtcaaaaattatgatgatgactaaca-----acaaggtagaa |
8447358 |
T |
 |
| Q |
100 |
gaagtgaagtgtatgaatta---------ttattattacatggattttgaggaaatcaggttttctgtgttcagctttggacatgttgagagagatgagt |
190 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8447359 |
gaagtgaagtgtatgaattattattattattattattacatggattttgaggaaatcaggttttctgtgttcagctttggacatgttgagagagatgagt |
8447458 |
T |
 |
| Q |
191 |
tggaattggatttctttctcattgagacatgcc |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
8447459 |
tggaattggatttctttctcattgagacatgcc |
8447491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University