View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10342_low_6 (Length: 488)
Name: NF10342_low_6
Description: NF10342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10342_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 349; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 349; E-Value: 0
Query Start/End: Original strand, 16 - 430
Target Start/End: Complemental strand, 8244059 - 8243650
Alignment:
| Q |
16 |
agacggtgatcaaaagtcttgatgggttggattttcttgtggtggattgtaggcttagggattttgctagggttcttaaggttgcaaaagtgagtactag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8244059 |
agacggtgatcaaaagtcttgatgggttggattttcttgtggtggattgtaggcttagggattttgctagggttcttaaggttgcaaaagtgagtactag |
8243960 |
T |
|
| Q |
116 |
aggggcagttttggcatgtaaaaatgcatggcaaaggtcaaatgtttcttggtttaaatggaatatggttcttgaaagaggcacacgtgtggttagatcg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8243959 |
aggggcagttttggcatgtaaaaatgcatggcaaaggtcaaatgtttcttggtttaaatggaatatggttcttgaaagaggcacacgtgtggttagatcg |
8243860 |
T |
|
| Q |
216 |
gnnnnnnngcctgttggaaagggtttggatattgcttacataggaagtagaattggtgggggtgcagcttcaagtactgcttcaaagagtactcctagcc |
315 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8243859 |
gtttttttgcctgttggaaagggtttggatattgcttacataggaagtagaattggtgggggtgcagcttcaagtagtgcttcaaagagtactcctagcc |
8243760 |
T |
|
| Q |
316 |
gttggatcaaactcatagatcaaaaatcaggagaagaacatctctatagagagtgatatcatatgtttaannnnnnnaatcttataatttaacagttaag |
415 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
8243759 |
gttggatcaaactcatagatcaaaaatcaggagaagaacatctctatagagagtg-----atatgtttaatttttttaatcttataatttaacagttaag |
8243665 |
T |
|
| Q |
416 |
ggtcgtattgtacgt |
430 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
8243664 |
ggtcgtattgtacgt |
8243650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University