View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10342_low_61 (Length: 237)
Name: NF10342_low_61
Description: NF10342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10342_low_61 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 36579913 - 36580140
Alignment:
| Q |
1 |
acatactatgatactacctcaagaaaaatagtacatacatacatagtaacatacagacaagggagatgctgcctagagattgtcagttgttggatatgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36579913 |
acatactatgatactacctcaagaaaaatagtacatacatacatagtaacatacagacaagggagatgctgcctagagattgtcagttgttggatatgat |
36580012 |
T |
 |
| Q |
101 |
ttgattaga-----catagtcgcccacgtttaactctcttaggaacacgtggctgttacaagaccaattnnnnnnngaatccaatttatatatgtcttca |
195 |
Q |
| |
|
||||||||| ||| | ||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36580013 |
ttgattagattagacatggacgcccacgtttaactctcttaggaacacgtggctgtttcaagaccaattaaaaaaagaatccaatttatatatgtcttca |
36580112 |
T |
 |
| Q |
196 |
ttgcatggggcattgtagcctcctaaat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
36580113 |
ttgcatggggcattgtagcctcctaaat |
36580140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University