View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10342_low_64 (Length: 223)
Name: NF10342_low_64
Description: NF10342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10342_low_64 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 69 - 206
Target Start/End: Original strand, 51004800 - 51004937
Alignment:
| Q |
69 |
tatgggtatttcccttggaagtgagttttgtaagattgaactaaatcaaattcaaattctatatgctattttaaaagcattatttcatattacataattt |
168 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51004800 |
tatgggtctttcccttggaagtgagttttgtaagattgaactaaatcaaattcaaattctatatgctattttaaaagcattatttcatattacataattt |
51004899 |
T |
|
| Q |
169 |
taaaaataaccttccaggtgttcacacaaagaaaacat |
206 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
51004900 |
taaaaataaccttccaggtgtttacacaaagaaaacat |
51004937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University